> For the complete documentation index, see [llms.txt](https://carlossilveiradesign.gitbook.io/mdef-diary/llms.txt). Markdown versions of documentation pages are available by appending `.md` to page URLs; this page is available as [Markdown](https://carlossilveiradesign.gitbook.io/mdef-diary/term-1/biology-zero.md).

# Biology Zero

## 1. About

The biology zero class approaches the idea of understanding how emergent technologies, mainly synthetic biology, are revolutionizing how we change our reality by genetically modifying different living beings within an ethical debate that asks what the limits and barriers are acceptable or not by society and how disruptive tools can transform the world depending on how our design choices are defined. Within this context, the class approaches bioethics and examples that translate the possibilities available nowadays and how artists and creative professionals make us rethink and create a dialogue between technologies, reality, and what can be possible in future years.

## 2. Class Journey

Since the first day Nuria presented and instigated ethical debates about changes in the world and how much of the things proposed nowadays are changing reality in practice or maybe even in a systematic way of thinking about the different structures of our world, from the economy to products, big techs, governmental implementations, laws and how they are attached between a strong lace complicated to break. Some examples pointed out by Nuria showing the possibilities of synthetic biology as an introduction for ethical debates showed some cases, as the man who modified his vision only to view the world in nocturnal mode, and how tools such as Cripsr-Cas9 can be powerful technologies depending on the hand of who uses and for what intentions.

> **What is life? Repetive information? It has a function and interacts.**

In sequence, Nuria introduced us to a short experiment to create a medium by following a list of five possible recipes that the class should achieve in five different groups, some of them used tomato sauce, yeast, milk, and other possible materials that could be found normally in the grocery store. Consequently, my group chose the recipe using milk, we converted the specific units to a small portion considering the tools we had in class, and we added the milk to the recipient, and then a little drop of lemon juice to split the proteins and nurture bacteria, heat to accelerate the process of maturation and then agar to create a more consist solid aspect to the matter.

<figure><img src="https://488160165-files.gitbook.io/~/files/v0/b/gitbook-x-prod.appspot.com/o/spaces%2FA9xYxeActKMHlmmkbDRK%2Fuploads%2FWfzvxaG0XlAmhdlqPUOo%2FSem%20ti%CC%81tulo-2.jpg?alt=media&amp;token=fd227566-fbd1-486b-bcb1-cc3bcae25f88" alt=""><figcaption></figcaption></figure>

<figure><img src="https://488160165-files.gitbook.io/~/files/v0/b/gitbook-x-prod.appspot.com/o/spaces%2FA9xYxeActKMHlmmkbDRK%2Fuploads%2Fw6qd964zpKhhwNNVWtHA%2FIMG_0388.jpeg?alt=media&amp;token=2a34cd2b-ff6e-420c-9a30-dddf1dd8a5ed" alt=""><figcaption></figcaption></figure>

By continuing the process, the mixes already made by all the class were sterilized inside of a pressure cooker with heated water inside to create a specific temperature through evaporation and humidity that would be notified through one particular tape sealing all the pots containing the medium that would be used. Then, at last, we took small Petri Dishes and splited our mediums into numerous pieces by using a table with a fire in the center, which should maintain the sterility of the mediums until they were placed and closed with the bottom to the top to avoid humidity and named by the sides to not distort the conditions after placing the bacterias.&#x20;

> **Negative and Positive Controls**
>
> Analyse different samples and interpratate what happened and what should been done next next considering the aims by measuring growth

**The Scientific Method**

<figure><img src="https://488160165-files.gitbook.io/~/files/v0/b/gitbook-x-prod.appspot.com/o/spaces%2FA9xYxeActKMHlmmkbDRK%2Fuploads%2FL0SwPsCN17JJ6INY5Pcu%2Fimage.png?alt=media&amp;token=ca3bdcbf-2ff9-403a-9d23-d30d66cf36e7" alt=""><figcaption></figcaption></figure>

Unfortunately, Petri Dishes containing my hair and booger from my nose didn't have enough conditions to react and grow, even with the recommendations of Nuria to maintain them in warm places as the heating system close to the windows. Considering this situation Nuria proposed the idea of using the incubator inside of the Biolab in specific temperatures in a more controlled environment that would promote the bacteria growth, which unfortunately didn't present drastic changes, but they were enough to see specific modifications on the mediums by pointing them to the light.

> **Bacterias Lunch:**
>
> 1. Acidity
> 2. CO2
> 3. Hydrogen
> 4. Aminoacids

<figure><img src="https://488160165-files.gitbook.io/~/files/v0/b/gitbook-x-prod.appspot.com/o/spaces%2FA9xYxeActKMHlmmkbDRK%2Fuploads%2FqM7IVucXhiGeLr0r9g5n%2FSem%20ti%CC%81tulo-1.jpg?alt=media&amp;token=0c20fc9c-b890-41b6-8e2c-ce5003e610fb" alt=""><figcaption></figcaption></figure>

With more bioethics discussion and reflections, Nuria presented a very clear vision of reality, not specifically about Synthetic Biology, but about how innovations are truly changing something and being accepted by the system we live in. However, in the second class were able to use microscopes, from purely digital ones connected to a computer to optic ones, where we could see some samples of different parts of the body, as the tongue, ovule, eye, and other available parts, as a histology class.

<figure><img src="https://488160165-files.gitbook.io/~/files/v0/b/gitbook-x-prod.appspot.com/o/spaces%2FA9xYxeActKMHlmmkbDRK%2Fuploads%2FN5yFjsUFANnlL7CfJpa9%2FIMG_0403.jpeg?alt=media&amp;token=bd06f91c-5328-4bc1-bb00-d6f400e05157" alt=""><figcaption></figcaption></figure>

> **Scales of Understading**
>
> 1. Quantum Mechanics&#x20;
> 2. Chemistry
> 3. Biochemistry
> 4. Molecular, Microbiology
> 5. Cellular Biology
> 6. Physiology

On the last day, we were presented with more technical aspects related to Synthetic Biology, by introducing to the class what are proteins, enzymes, amino-acids, their variations and compositions, and maybe the most important part of it, the Central Dogma, which implies understanding how encoded DNA can is transcripted to RNA and them, at last to a protein that bacterias can express to achieve a determined function. These explanations included the idea of how bacteria grow, what they eat, and how they grow into certain specific conditions, which is followed by how companies are using technologies to sell doubtful and distorted ideas about understanding our genome and predict behaviors and even change characteristics with Crispr to change future generations.

At last, Nuria introduced us to one last experiment by presenting us with how to produce cellulose with Kombucha by fermentation and using sugar to nourish them and exemplified a real project she participated in using spirulina, a matter consisting in the harvesting of living ciano bacteria that could be eaten by people as a supplement with a high level of proteins even compared with meat. To close the class, we ate spirulina from the company Nuria worked with and added pure to bread and some sweets with it inside.

<figure><img src="https://488160165-files.gitbook.io/~/files/v0/b/gitbook-x-prod.appspot.com/o/spaces%2FA9xYxeActKMHlmmkbDRK%2Fuploads%2Fkj6NZAVLEo9jQFIfWhgD%2FIMG_0437.jpeg?alt=media&amp;token=af57f293-b49c-4747-b56a-52cf27719fd5" alt=""><figcaption></figcaption></figure>

## 3. Project Briefing

Design a Genetically Modified Organism. The deliverable must include a description of the "problem" and how the GMO will solve it, one or some genes of interest, and the host organism that will "receive" them. All ideas are valid if you attach the scientific paper references that inspired them. Here is the link to iGEM genes and genetic parts and some of my favorite projects to inspire you.

### 3.1 Topic Area

The idea of this project relates to the concept of creating my own Genetically Modified Organisms (GMO) to produce/grow tissues with new functionalities that could improve Soft Robotics autonomy considering its capabilities through the environment without physical inputs. Most Soft Robotics rely on activating physical reactions to improve movement, however, with Synthetic Biology it would be plausible to create a tissue containing biochemical sensors that could initiate the engine to stimulate physical reactions to its movements, in different contexts/environments.

### 3.2 System

The aimed system for the project is based on a simple biochemical sensor that could react to certain chemicals produced by the body before having a complete stroke cycle, the idea envisions a prevention mechanism that could be grown within human tissues, easily accepted by the body, that could open intravascular ramifications in the brain and avoid the process that harms and causes numerous damages to the organ and consequently mental processes and sense perception.&#x20;

<table><thead><tr><th>Chemical Input</th><th>Physical Output</th><th data-hidden></th></tr></thead><tbody><tr><td>0</td><td>1</td><td></td></tr><tr><td>1</td><td>0</td><td></td></tr></tbody></table>

### 3.3 Device-Level Design

To create the device is important to understand which kinds of chemicals can be measured during an ischemic stroke, where a blood cot enters inside one ramification and interrupts the passage of air in certain parts causing damage and the death of a specific area unidentified before several consequences appear externally. As a consequence, besides the physical reactions of the brain tissue, the lower levels of oxygen (Hypoxia) can indicate a disruption in the balance of Ions to a chemical reaction that a biosensor could measure to induce a reaction into the tissue where it will be applied to open the intravascular structures.

<table><thead><tr><th>Input </th><th>Output</th><th data-hidden></th></tr></thead><tbody><tr><td>Lower Levels of Oxygen</td><td>Tissue structure deforming</td><td></td></tr><tr><td>Stable levels of Oxygen</td><td>No deformation</td><td></td></tr></tbody></table>

For this specific proposal, the device designs would need an Oxygen Meter and a Morphology-Deforming system that could change the structure of the engineered tissue to open the space and let blood flow through the brain's intravascular channels.

| Input  | 2            | 3               | Output   |
| ------ | ------------ | --------------- | -------- |
| Oxygen | Oxygen Meter | Tissue Reaction | New Form |

<figure><img src="https://488160165-files.gitbook.io/~/files/v0/b/gitbook-x-prod.appspot.com/o/spaces%2FA9xYxeActKMHlmmkbDRK%2Fuploads%2FrqgjfosjPLzhDVnvlfVD%2FLogic_Gate.png?alt=media&amp;token=fd64cd60-f31b-465b-89f2-0388c413b6d7" alt=""><figcaption></figcaption></figure>

**Input:** Oxygen

**Not gate:** Inverts the oxygen level: Low O₂ = 1, High O₂ = 0

**Buffer 1:** Sends the signal to the reaction system

**Buffer 2:** Triggers deformation if a chemical reaction is active

**Oxygen Meter:**

Degradation of HIF-1α Is Controlled by an Oxygen-Dependent Degradation Domain. In search of regions within HIF-1α that regulate its degradation by the ubiquitin-proteasome pathway, we made use of Gal4 fusion expression vectors in which the Gal4 DNA binding domain was linked in frame with portions of HIF-1α. HREs are composite regulatory elements, comprising a conserved HIF-binding sequence and a highly variable flanking sequence that modulates the transcriptional response. In summary, the transcriptional response of a cell is the end product of two major functions. The first (trans-acting) is the level of activation of the HIF pathway that depends on the regulation of stability and transcriptional activity of the HIF-α. (NHI)

**Tissue Reaction:**

RhoA as well as several other members of the Rho family are identified as having roles in the regulation of the cytoskeleton and cell division. RhoA plays a pivotal role in G1 cell cycle progression, primarily through the regulation of cyclin D1 and cyclin-dependent kinase inhibitors (p21 and p27) expression.

### 3.4 Parts

<figure><img src="https://488160165-files.gitbook.io/~/files/v0/b/gitbook-x-prod.appspot.com/o/spaces%2FA9xYxeActKMHlmmkbDRK%2Fuploads%2Fwhjd6tVOaPJTXZS6z17d%2FSensor.png?alt=media&amp;token=31d410c1-6c8d-44a0-a17b-3c89f7d6cbc1" alt=""><figcaption></figcaption></figure>

**Sensor:** HRE - TCGACTGCCACGTCG: Hypoxia response element where HIF1α binds.&#x20;

**Promoter:** TATAA - TATA Vox (minimal eukaryotic promoter)

**RBS:** Kozak: GCCGCCACC - Kozak sequence preceding the start of the RhoA gene.&#x20;

**Protein Expression:** GCG TCC TGG CAG CTT ACG GAA CGT: Part of the RhoA gene.&#x20;

**Terminator:** PolyA **-** Sequence that terminates transcription (polyadenylation, if in a mammalian cell).

### 3.5 DNA

**Sensors:** NM\_001530

```
agtgcacagt gctgcctcgt ctgaggggac aggaggatca ccctcttcgt cgcttcggcc agtgtgtcgg gctgggccct gacaagccac ctgaggagag gctcggagcc gggcccggac cccggcgatt gccgcccgct tctctctagt ctcacgaggg gtttcccgcc tcgcaccccc acctctggac ttgcctttcc ttctcttctc cgcgtgtgga gggagccagc gcttaggccg gagcgagcct gggggccgcc cgccgtgaag acatcgcggg gaccgattca ccatggaggg cgccggcggc gcgaacgaca agaaaaagat aagttctgaa cgtcgaaaag aaaagtctcg agatgcagcc agatctcggc gaagtaaaga atctgaagtt ttttatgagc ttgctcatca gttgccactt ccacataatg tgagttcgca tcttgataag gcctctgtga tgaggcttac catcagctat ttgcgtgtga ggaaacttct ggatgctggt gatttggata ttgaagatga catgaaagca cagatgaatt gcttttattt gaaagccttg gatggttttg ttatggttct cacagatgat ggtgacatga tttacatttc tgataatgtg aacaaataca tgggattaac tcagtttgaa ctaactggac acagtgtgtt tgattttact catccatgtg accatgagga aatgagagaa atgcttacac acagaaatgg ccttgtgaaa aagggtaaag aacaaaacac acagcgaagc ttttttctca gaatgaagtg taccctaact agccgaggaa gaactatgaa cataaagtct gcaacatgga aggtattgca ctgcacaggc cacattcacg tatatgatac caacagtaac caacctcagt gtgggtataa gaaaccacct atgacctgct tggtgctgat ttgtgaaccc attcctcacc catcaaatat tgaaattcct ttagatagca agactttcct cagtcgacac agcctggata tgaaattttc ttattgtgat gaaagaatta ccgaattgat gggatatgag ccagaagaac ttttaggccg ctcaatttat gaatattatc atgctttgga ctctgatcat ctgaccaaaa ctcatcatga tatgtttact aaaggacaag tcaccacagg acagtacagg atgcttgcca aaagaggtgg atatgtctgg gttgaaactc aagcaactgt catatataac accaagaatt ctcaaccaca gtgcattgta tgtgtgaatt acgttgtgag tggtattatt cagcacgact tgattttctc ccttcaacaa acagaatgtg tccttaaacc ggttgaatct tcagatatga aaatgactca gctattcacc aaagttgaat cagaagatac aagtagcctc tttgacaaac ttaagaagga acctgatgct ttaactttgc tggccccagc cgctggagac acaatcatat ctttagattt tggcagcaac gacacagaaa ctgatgacca gcaacttgag gaagtaccat tatataatga tgtaatgctc ccctcaccca acgaaaaatt acagaatata aatttggcaa tgtctccatt acccaccgct gaaacgccaa agccacttcg aagtagtgct gaccctgcac tcaatcaaga agttgcatta aaattagaac caaatccaga gtcactggaa ctttctttta ccatgcccca gattcaggat cagacaccta gtccttccga tggaagcact agacaaagtt cacctgagcc taatagtccc agtgaatatt gtttttatgt ggatagtgat atggtcaatg aattcaagtt ggaattggta gaaaaacttt ttgctgaaga cacagaagca aagaacccat tttctactca ggacacagat ttagacttgg agatgttagc tccctatatc ccaatggatg atgacttcca gttacgttcc ttcgatcagt tgtcaccatt agaaagcagt tccgcaagcc ctgaaagcgc aagtcctcaa agcacagtta cagtattcca gcagactcaa atacaagaac ctactgctaa tgccaccact accactgcca ccactgatga attaaaaaca gtgacaaaag accgtatgga agacattaaa atattgattg catctccatc tcctacccac atacataaag aaactactag tgccacatca tcaccatata gagatactca aagtcggaca gcctcaccaa acagagcagg aaaaggagtc atagaacaga cagaaaaatc tcatccaaga agccctaacg tgttatctgt cgctttgagt caaagaacta cagttcctga ggaagaacta aatccaaaga tactagcttt gcagaatgct cagagaaagc gaaaaatgga acatgatggt tcactttttc aagcagtagg aattggaaca ttattacagc agccagacga tcatgcagct actacatcac tttcttggaa acgtgtaaaa ggatgcaaat cta 
```

**Promoter:** TATA Box

```
5' - TATAAA - 3'
```

**RBS:** NM\_001664

```
ATGGAGGAGGAGGAGGAGGAGGAGGAAGGAGGAGGAAGGAGGAAGGAGGAAGGAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGA
```

**Protein Expression:** NM\_001664

```
ATGGAGGAGGAGGAGGAGGAGGAGGAAGGAGGAGGAAGGAGGAAGGAGGAAGGAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGGAAGGAGG
```

**Terminator:** Hairpin loop (Stem-loop)

```
5' - GCGTAAAGCGCTTGCGAATTCGCGAA - 3'
```

**Backbone:** pX330

```
CATGTGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAAT TGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTT GGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATT TCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGGGTCTTCGAGAAGACCTGTTTTAGA GCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTT TTTTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTTTTAGCGCGTGCGCCAATTCTG CAGACAAATGGCTCTAGAGGTACCCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAAC GACCCCCGCCCATTGACGTCAATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATT TACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAA TGACGGTAAATGGCCCGCCTGGCATTGTGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTAC ATCTACGTATTAGTCATCGCTATTACCATGGTCGAGGTGAGCCCCACGTTCTGCTTCACTCTCCCCATCT CCCCCCCCTCCCCCCCCCCAATTTTGTATTTATTTATTTTTTAATTATTTTGTGCGGGGGGGGGGGGGGG GGGGGGGGGGGGCGCGCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCGAGGCGGAGAGGTG CGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCGGCGGCGGCGGCGGCC CTATAAAAAGCGAAGCGCGCGGCGGGCGGGAGTCGCTGCGCGCTGCCTTCGCCCCGTGCCCCGCTCCGCC GCCGCCTCGCGCCGCCCGCCCCGGCTCTGACTGACCGCGTTACTCCCACAGGTGAGCGGGCGGGACGGCC CTTCTCCTCCGGGCTGTAATTAGCTGAGCAAGAGGTAAGGGTTTAAGGGATGGTTGGTTGGTGGGGTATT AATGTTTAATTACCTGGAGCACCTGCCTGAAATCACTTTTTTTCAGGTTGGACCGGTGCCACCATGGACT ATAAGGACCACGACGGAGACTACAAGGATCATGATATTGATTACAAAGACGATGACGATAAGATGGCCCC AAAGAAGAAGCGGAAGGTCGGTATCCACGGAGTCCCAGCAGCCGACAAGAAGTACAGCATCGGCCTGGAC ATCGGCACCAACTCTGTGGGCTGGGCCGTGATCACCGACGAGTACAAGGTGCCCAGCAAGAAATTCAAGG TGCTGGGCAACACCGACCGGCACAGCATCAAGAAGAACCTGATCGGAGCCCTGCTGTTCGACAGCGGCGA AACAGCCGAGGCCACCCGGCTGAAGAGAACCGCCAGAAGAAGATACACCAGACGGAAGAACCGGATCTGC TATCTGCAAGAGATCTTCAGCAACGAGATGGCCAAGGTGGACGACAGCTTCTTCCACAGACTGGAAGAGT CCTTCCTGGTGGAAGAGGATAAGAAGCACGAGCGGCACCCCATCTTCGGCAACATCGTGGACGAGGTGGC CTACCACGAGAAGTACCCCACCATCTACCACCTGAGAAAGAAACTGGTGGACAGCACCGACAAGGCCGAC CTGCGGCTGATCTATCTGGCCCTGGCCCACATGATCAAGTTCCGGGGCCACTTCCTGATCGAGGGCGACC TGAACCCCGACAACAGCGACGTGGACAAGCTGTTCATCCAGCTGGTGCAGACCTACAACCAGCTGTTCGA GGAAAACCCCATCAACGCCAGCGGCGTGGACGCCAAGGCCATCCTGTCTGCCAGACTGAGCAAGAGCAGA CGGCTGGAAAATCTGATCGCCCAGCTGCCCGGCGAGAAGAAGAATGGCCTGTTCGGAAACCTGATTGCCC TGAGCCTGGGCCTGACCCCCAACTTCAAGAGCAACTTCGACCTGGCCGAGGATGCCAAACTGCAGCTGAG CAAGGACACCTACGACGACGACCTGGACAACCTGCTGGCCCAGATCGGCGACCAGTACGCCGACCTGTTT CTGGCCGCCAAGAACCTGTCCGACGCCATCCTGCTGAGCGACATCCTGAGAGTGAACACCGAGATCACCA AGGCCCCCCTGAGCGCCTCTATGATCAAGAGATACGACGAGCACCACCAGGACCTGACCCTGCTGAAAGC TCTCGTGCGGCAGCAGCTGCCTGAGAAGTACAAAGAGATTTTCTTCGACCAGAGCAAGAACGGCTACGCC GGCTACATTGACGGCGGAGCCAGCCAGGAAGAGTTCTACAAGTTCATCAAGCCCATCCTGGAAAAGATGG ACGGCACCGAGGAACTGCTCGTGAAGCTGAACAGAGAGGACCTGCTGCGGAAGCAGCGGACCTTCGACAA CGGCAGCATCCCCCACCAGATCCACCTGGGAGAGCTGCACGCCATTCTGCGGCGGCAGGAAGATTTTTAC CCATTCCTGAAGGACAACCGGGAAAAGATCGAGAAGATCCTGACCTTCCGCATCCCCTACTACGTGGGCC CTCTGGCCAGGGGAAACAGCAGATTCGCCTGGATGACCAGAAAGAGCGAGGAAACCATCACCCCCTGGAA CTTCGAGGAAGTGGTGGACAAGGGCGCTTCCGCCCAGAGCTTCATCGAGCGGATGACCAACTTCGATAAG AACCTGCCCAACGAGAAGGTGCTGCCCAAGCACAGCCTGCTGTACGAGTACTTCACCGTGTATAACGAGC TGACCAAAGTGAAATACGTGACCGAGGGAATGAGAAAGCCCGCCTTCCTGAGCGGCGAGCAGAAAAAGGC CATCGTGGACCTGCTGTTCAAGACCAACCGGAAAGTGACCGTGAAGCAGCTGAAAGAGGACTACTTCAAG AAAATCGAGTGCTTCGACTCCGTGGAAATCTCCGGCGTGGAAGATCGGTTCAACGCCTCCCTGGGCACAT ACCACGATCTGCTGAAAATTATCAAGGACAAGGACTTCCTGGACAATGAGGAAAACGAGGACATTCTGGA AGATATCGTGCTGACCCTGACACTGTTTGAGGACAGAGAGATGATCGAGGAACGGCTGAAAACCTATGCC CACCTGTTCGACGACAAAGTGATGAAGCAGCTGAAGCGGCGGAGATACACCGGCTGGGGCAGGCTGAGCC GGAAGCTGATCAACGGCATCCGGGACAAGCAGTCCGGCAAGACAATCCTGGATTTCCTGAAGTCCGACGG CTTCGCCAACAGAAACTTCATGCAGCTGATCCACGACGACAGCCTGACCTTTAAAGAGGACATCCAGAAA GCCCAGGTGTCCGGCCAGGGCGATAGCCTGCACGAGCACATTGCCAATCTGGCCGGCAGCCCCGCCATTA AGAAGGGCATCCTGCAGACAGTGAAGGTGGTGGACGAGCTCGTGAAAGTGATGGGCCGGCACAAGCCCGA GAACATCGTGATCGAAATGGCCAGAGAGAACCAGACCACCCAGAAGGGACAGAAGAACAGCCGCGAGAGA ATGAAGCGGATCGAAGAGGGCATCAAAGAGCTGGGCAGCCAGATCCTGAAAGAACACCCCGTGGAAAACA CCCAGCTGCAGAACGAGAAGCTGTACCTGTACTACCTGCAGAATGGGCGGGATATGTACGTGGACCAGGA ACTGGACATCAACCGGCTGTCCGACTACGATGTGGACCATATCGTGCCTCAGAGCTTTCTGAAGGACGAC TCCATCGACAACAAGGTGCTGACCAGAAGCGACAAGAACCGGGGCAAGAGCGACAACGTGCCCTCCGAAG AGGTCGTGAAGAAGATGAAGAACTACTGGCGGCAGCTGCTGAACGCCAAGCTGATTACCCAGAGAAAGTT CGACAATCTGACCAAGGCCGAGAGAGGCGGCCTGAGCGAACTGGATAAGGCCGGCTTCATCAAGAGACAG CTGGTGGAAACCCGGCAGATCACAAAGCACGTGGCACAGATCCTGGACTCCCGGATGAACACTAAGTACG ACGAGAATGACAAGCTGATCCGGGAAGTGAAAGTGATCACCCTGAAGTCCAAGCTGGTGTCCGATTTCCG GAAGGATTTCCAGTTTTACAAAGTGCGCGAGATCAACAACTACCACCACGCCCACGACGCCTACCTGAAC GCCGTCGTGGGAACCGCCCTGATCAAAAAGTACCCTAAGCTGGAAAGCGAGTTCGTGTACGGCGACTACA AGGTGTACGACGTGCGGAAGATGATCGCCAAGAGCGAGCAGGAAATCGGCAAGGCTACCGCCAAGTACTT CTTCTACAGCAACATCATGAACTTTTTCAAGACCGAGATTACCCTGGCCAACGGCGAGATCCGGAAGCGG CCTCTGATCGAGACAAACGGCGAAACCGGGGAGATCGTGTGGGATAAGGGCCGGGATTTTGCCACCGTGC GGAAAGTGCTGAGCATGCCCCAAGTGAATATCGTGAAAAAGACCGAGGTGCAGACAGGCGGCTTCAGCAA AGAGTCTATCCTGCCCAAGAGGAACAGCGATAAGCTGATCGCCAGAAAGAAGGACTGGGACCCTAAGAAG TACGGCGGCTTCGACAGCCCCACCGTGGCCTATTCTGTGCTGGTGGTGGCCAAAGTGGAAAAGGGCAAGT CCAAGAAACTGAAGAGTGTGAAAGAGCTGCTGGGGATCACCATCATGGAAAGAAGCAGCTTCGAGAAGAA TCCCATCGACTTTCTGGAAGCCAAGGGCTACAAAGAAGTGAAAAAGGACCTGATCATCAAGCTGCCTAAG TACTCCCTGTTCGAGCTGGAAAACGGCCGGAAGAGAATGCTGGCCTCTGCCGGCGAACTGCAGAAGGGAA ACGAACTGGCCCTGCCCTCCAAATATGTGAACTTCCTGTACCTGGCCAGCCACTATGAGAAGCTGAAGGG CTCCCCCGAGGATAATGAGCAGAAACAGCTGTTTGTGGAACAGCACAAGCACTACCTGGACGAGATCATC GAGCAGATCAGCGAGTTCTCCAAGAGAGTGATCCTGGCCGACGCTAATCTGGACAAAGTGCTGTCCGCCT ACAACAAGCACCGGGATAAGCCCATCAGAGAGCAGGCCGAGAATATCATCCACCTGTTTACCCTGACCAA TCTGGGAGCCCCTGCCGCCTTCAAGTACTTTGACACCACCATCGACCGGAAGAGGTACACCAGCACCAAA GAGGTGCTGGACGCCACCCTGATCCACCAGAGCATCACCGGCCTGTACGAGACACGGATCGACCTGTCTC AGCTGGGAGGCGACAAAAGGCCGGCGGCCACGAAAAAGGCCGGCCAGGCAAAAAAGAAAAAGTAAGAATT CCTAGAGCTCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCG TGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCA TTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAA GAGAATAGCAGGCATGCTGGGGAGCGGCCGCAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGC GCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTC AGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGGGGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGC GGTATTTCACACCGCATACGTCAAAGCAACCATAGTACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGG TGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCTTAGCGCCCGCTCCTTTCGCTTTCTTC CCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCC GATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTTGGGTGATGGTTCACGTAGTGGGCCATC GCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAA ACTGGAACAACACTCAACTCTATCTCGGGCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGTCT ATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGTTTACAAT TTTATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACA CCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCG GGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGACGAAAGGGCCTCGTGATACG CCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAAT GTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAAC CCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTAT TCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCT GAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTT TTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCG TATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCA CCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGA GTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCA CAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGAC GAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTA CTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTC GGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGAAGCCGCGGTATCATT GCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTA TGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCA AGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATC CTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAG AAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACC ACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTC AGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTG TAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTG TCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCG TGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAA GCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCG CACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTT GAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTT TACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCA         
```

### 3.6 Plasmid

The plasmid developed tries to match the DNA sequences collected and tries to allocate each one inside of the pX330 plasmid backbone wich should had more flexibility and facility to by genetically modified and cut using Cripsr-Cas9. However, since my conversation with Nuria during the Design Dialogues event, an easier and more intelligent approach to these specific projects would be the use of muscles genetically modified by applying the Hipoxia sensor into them, considering its reactive properties that change the cytoskeleton formation of the cells.

<figure><img src="https://488160165-files.gitbook.io/~/files/v0/b/gitbook-x-prod.appspot.com/o/spaces%2FA9xYxeActKMHlmmkbDRK%2Fuploads%2Fg9KWmRgCTqVu4XfVbxjX%2FCaptura%20de%20Tela%202024-12-11%20a%CC%80s%205.21.11%E2%80%AFPM.png?alt=media&amp;token=86cd3a32-d6c6-4855-a4be-cb54a9333da0" alt=""><figcaption></figcaption></figure>

### 3.7 Assembly

To make the project a reality, it would be important to use different technologies to synthesize the genetically modified DNA and then insert the plasmid into a Stem cell chassis that can be easily accepted by the human body with any possible risks and negative reactions. The first step would be to synthesize the DNA sequence with specific suppliers that could deliver the entire plasmid sequence already built, such as Twist Bioscience, and then initiate some PCR procedures that could replicate the sequence into more numerous quantities to start implementing the sequences into Stem Cells.

However, due to Nuria's feedback and the possibility of working with muscle cells and not exactly the plasmid layout designed before, it would be easier to use CRISPR-Cas9 to genetically modify the muscle cell sequence and reprogram them by inserting the Hipoxia sensor HRE-H1f1 Alfa. However considering this possibility and the idea of replicating them, it still would be necessary the use PCR process to replicate the modified sequences and them grow in the lab. In addition, another possibility that would make this assembly easier is the Gibsom Assembly process, which can unite different fragments of DNA sequence into one isothermic reaction.

### 3.8 Growth/Morphology

<figure><img src="https://488160165-files.gitbook.io/~/files/v0/b/gitbook-x-prod.appspot.com/o/spaces%2FA9xYxeActKMHlmmkbDRK%2Fuploads%2FOSwdx7wj01jEGWfeXlEP%2Fsoft-robotic.svg?alt=media&amp;token=04489b28-70c8-40ec-ac9a-73b3bd132d90" alt=""><figcaption></figcaption></figure>

At last, the host of the designed sequence will be grown and not necessarily inserted, with both alternatives already assembled, the next important part of the process is related to the physiological form of the nano soft robot that will be inserted inside of the brain and how it will be shaped to react chemically to the levels of oxygen in on specific part of the brain and unfold itself to open space in case of ischemic strokes situations.  As a consequence of the research, and confirming the morphology of our vein structure in an ocular tube shape, its would be important to consider the shape of robot before and after the reactions.

For this, it was created a Y-shaped robot with legs that unfold from the middle, which stays firstly as a circle and then opens by spreading two levels of extension, one rigid structure at the beginning and a second one with thinner legs and grips that would be attached to the walls of veins to avoid movement considering the pressure of blood circulation it's needed to pass through. The Y-shaped was chosen with the idea to extend as much as possible the veins and not use a lot of space to let the blood passage flow, a decision that explains the circle in the middle of the robot.

To provide movement from inside to outside, the intersection between the legs is concave in a 3D perspective, this would allow a more direct motion reaction from the robots and avoid different folding shapes during the stroke process. In addition, one thing that could facilitate the process would be the use of 4D printing techniques with bioprinters, by mixing the DNA sequences into hydrogels, but only placing the GMOs in the contortion parts, so the other parts could be grown with a more rigid structure to sustain the Y-Shaped robot inside of the brain.

<figure><img src="https://488160165-files.gitbook.io/~/files/v0/b/gitbook-x-prod.appspot.com/o/spaces%2FA9xYxeActKMHlmmkbDRK%2Fuploads%2FlCMtp7gjZIH6r8grUZql%2Frobo_Prancheta%201.jpg?alt=media&amp;token=9064faf9-eb53-4de8-9118-b2dfb29eb90d" alt=""><figcaption></figcaption></figure>

<figure><img src="https://488160165-files.gitbook.io/~/files/v0/b/gitbook-x-prod.appspot.com/o/spaces%2FA9xYxeActKMHlmmkbDRK%2Fuploads%2FGRPPlRp1lww1njQwBNyT%2Frobo_Prancheta%201%20co%CC%81pia.jpg?alt=media&amp;token=3c084035-828b-4023-a837-63890469782a" alt=""><figcaption></figcaption></figure>

### 3.9 References

1. <https://www.researchgate.net/figure/Soft-robots-from-meter-to-sub-mm-a-Vascular-system-adapted-swimming-soft-robot-b_fig1_335952274>
2. <https://www.nature.com/articles/s41598-019-43618-4>
3. <https://pmc.ncbi.nlm.nih.gov/articles/PMC2536516/>
4. <https://pmc.ncbi.nlm.nih.gov/articles/PMC5167403/>
